1) The sequence of part of a mRNA is:

5'-AUGGGGAACAGCAAGAGUGGGCCCUGUCCAAGGAG-3'

a) What is the sequence of the DNA coding strand?
b) What is the sequence of the  DNA template strand?

a) Calculate the percentage of the E.coli genome that is not transcribed.
b) Although many mammalian genes are larger than bacterial genes, most mammalian gene products are the same size as bacterial gene products.
    Calculate the percentage of DNA in exons in mammalian genes.

a) Would you expect this gene to be properly transcribed by prokaryotic RNA polymerase?
b) What about the converse situation, where an intact prokaryotic gene is introduced into a eukaryotic cell; will it be properly transcribed by the eukaryotic transcription complex?

5) When b-[³²P]-ATP (ATP has ³²P label at the "second" phosphate) is incubated with a eukaryotic cell extract that is capable of transcription and RNA processing, where does the label appear in mRNA?

6) A segment of DNA from the middle of the E.Coli gene has the sequence below:

~CCGGCTAAGATCTGACTAGC~

Write the mRNA sequences that can be produced by transcribing the sequence in either direction.

7) Unlike DNA polymerase, RNA polymerase does not have proof-reading ability.  Explain why the  lack of proof-reading activity in RNA polymerases  is not detrimental to the cell.

8) Cordycepin  (3'deoxyadenosine)  inhibits poly(A) synthesis  at low concentrations and  RNA synthesis at higher concentrations.

a) What is the basis of inhibition by cordycepin?
b) Why is poly(A) synthesis more sensitive to the presence of cordycepin?
c) Does cordycepin need to be modified to exert its effect?

9) Suggest a means by which you could separate mRNA from other types of RNA in a eukaryotic cell extract.

10) Why are mutations within an intron of a protein coding gene sometimes detrimental?

11) A deletion in  the gene for triose phosphate isomerase moves the branch site to a new location 7 nucleotides away from the 3'-splice acceptor sequence.
     Will this deletion have any effect on splicing the gene?

12) The standard genetic code is read in codons that are 3 bases long.  How many possible reading frames are there on a single piece of double stranded DNA?

13) Examine the mRNA molecules that can be transcribed from DNA  shown in problem 6.  Assuming that the DNA segment is from the middle of a protein coding gene, which of the possible mRNA's are most likely to be an actual transcript?  What is the sequence of the encoded peptide?

14) Aminoacyl-tRNA synthetases are said to be the only component of gene expression that decodes the genetic code. Explain.

15) The formation of isoleucyl-tRNA proceeds through the reversible   formaton of an enzyme bound  Ile-AMP intermediate. Predict whether ³²P-ATP is formed from ³²PP_i when each of the following is incubated  with the specific activating enzyme:

a) ATP and ³²PP_i
b) tRNA , ATP and ³²PP_i
c) Ile, ATP, and ³²PP_i

17) Given that the genetic code is universal, would plant mRNA by correctly translated by a prokaryotic cell like E.coli?

18) tRNA is absolutely essential for peptide synthesis.  Name five different cellular components that can bind to (interact with) tRNA.

19) Bacterial genomes usually contain multiple copies of the genes for rRNA. These genes are transcribed very efficiently to provide large amounts of rRNA for ribosome assembly.  In contrast, the genes that encode ribosomal proteins are present as single copies.  Explain the difference in the number of copies of rRNA and ribosomal protein genes.

20) Hydrolysis of phosphoanhydride bonds during peptide synthesis represents energy consumed.  Calculate the number of phosphoanhydride bonds that are hydrolyzed during synthesis of a 600 amino acid long protein in E.coli. (Do not include the energy required to synthesize the amino acids, mRNA, tRNA or  the ribosomes.)
 

Solutions for Problem Set #1:

Solution to #1

Solution to #2

Solution to #3

Solution to #4

Solution to #5

Solution to #6

Solution to #7

Solution to #8

Solution to #9

Solution to #10

Solution to #11

Solution to #12

Solution to #13

Solution to #14

Solution to #15

Solution to #16

Solution to #17

Solution to #18

Solution to #19

Solution to #20

Go Back to CHE 472 Syllabus