1) Compare hydrogen bonding in the a helix of proteins to hydrogen bonding in the double helix of DNA. Include in the answer the role that hydrogen bonding plays in stablizing these two structures.
2) A stretch of double-stranded DNA contains 1000 base pairs, and its base composition is 58% G+C. How many deoxythymidine residues are in this region of DNA?
3) DNA molecules can be cleaved
into fragments by the action of restriction endonucleases that catalyze
cleavage at specific palindromic sequences.
a) Identify the palindromic sequence in the duplex DNA molecule shown below.b) Consult Table 19.4 in your textbook to determine which restriction endonuclease cleaves this sequence.
c) Indicate the DNA fragments that are generated by this endonuclease.
DNA sequence:
5'AAGCTGCCTAAGCTTTTGCGCTGCGCCTCGGCGCG3'
3'TTCGACGGATTCGAAAACGCGACGCGGAGCCGCGC5'
4) One of the original structures
of DNA had all of the phosphate groups positioned in the center of a long
fiber. Give a reason why this proposal was rejected.
5) A highly purified DNA sample gave an A260 at 25°C of 0.45. The sample was divided into two and each was treated as follows:
| Sample I | Sample II |
| 1) Heat
to 100°C
A260(100°C)=0.65 |
1) Heat
to 100°C
A260(100°C)=0.65 |
| 2) Quick
cool in ice water
A260(25°C)= 0.55 |
2) Very
slow cool to 25°C
A260(25°C)=0.46 |
Explain:
a) why the A260 readings for the samples at 100°C are higher than those measured before heating.b) why different A260 readings are obtained at 25°C when the sample is quick cooled compared to the sample being slowly cooled.
6) A sample of purified DNA
was incubated with deoxyribonuclease (DNAase) at 37°C. An aliquot was
removed from the reaction mixture every minute for 5 minutes and the A260
recorded. The following data were obtained.
| Time (min.) | A260 |
| 0 | 0.60 |
| 1 | 0.64 |
| 2 | 0.67 |
| 3 | 0.70 |
| 4 | 0.72 |
| 5 | 0.73 |
Describe the action of DNAase on DNA and explain the increase in A260 that is observed.
7) Poly A forms a single-stranded helix. What forces stablize this structure?
8) a) Draw a structure for single stranded DNA with the sequence pdAGCT. Indicate in your structure where on the bases that hydrogen bonds will form with a complimentary strand. What would the sequence of the complimentary strand be?
9) A DNA molecule with the sequence pdApdGpdTpdC can be cleaved by exonucleases. List the products of a single reaction catalyzed by these enzymes:
a) a 3'->5' exonuclease that cleaves the 3' ester bond of a phosphodiester linkage.10) The free living soil nematode C.elegans was the first metazoan to have its entire 100 Mb genome sequenced. Overall the worm genome is 36% (G+C) and 64%(A+T). The restriction endonuclease HindIII recognizes and cuts the hexameric palindromic sequence
b) a 5'->3' exonuclease that cleves the 5' ester bond of a phosphodiester linkage.
c) a 5'->3 exonuclease that cleaves the 3' ester bond of a phosophodiester linkage.
Problem #1